Serum Homocysteine Levels and its Methylenetetrahydrofolate Gene (MTHFR) C677t Polymorphism in Patients with Hemodialysis

Abstract

Homocysteine plays an important role in cardiovascular disease as an independent risk factor, especially in patients with renal insufficiency. The present study aimed to determine whether Hcy levels, or those of its C677T polymorphism, were associated with higher mortality in patients submitted to chronic hemodialysis treatment. This was a descriptive, prospective study. Chronic renal patients undergoing hemodialysis in the "General Hospital, ISSSTE" Dr. Darío Fernández Fierro, Mexico City were included in the study. Serum homocysteine was analyzed by means of an ELISA test. The primers utilized for MTHFR C677T polymorphism identification were the following: F: 5'TGAAGGAGAAGGTGTCTGCGGGA3', R: 5'AGGACGGTGCGGTGAGTG3' and F2: 5’GCAGGGAGCTTTGAGGCTGAC3’. Differences among nominal conditions were evaluated by the Mann-Whitney U-test. Spearman test was used for correlation among variables. Regression, log-linear analysis and receiver operating characteristic (ROC) curves were conducted to evaluate the possible influence on prognosis of Hcy levels and the presence of the MTHFR C677T polymorphism. Cox regression and Kaplan-Meier tests were performed to evaluate the Hcy levels influence on survival. In all cases, p<0.05 was considered statistically significant. All tests were performed with the SPSS ver. 23 statistical software program. By means of regression analysis (p = 0.046) and ROC curve age was the sole significant prognostic variable for the "death". The loglinear analysis did not show any association between the presence of MTHFR C677T SNP with the mortality of patients. It was concluded that Hcy levels and the presence/absence of MTHFR C677T are not stronger predictors for mortality than the traditional cardiovascular risk factors.